Trending ▼   ResFinder  

CBSE Class 12 Pre Board 2020 : Biology (Kendriya Vidyalaya (KV) Agra)

8 pages, 63 questions, 0 questions with responses, 0 total responses,    0    0
CBSE 12 Pre Boards
  
+Fave Message
 Home > cbse12_pre_boards >   F Also featured on: School Page cbse12 and 1 more

Formatting page ...

KENDRIYA VIDYALAYA SANGATHAN, AGRA REGION PRE BOARD EXAM -2019-20 CLASS XII SET H MAX.TIME 3 H SUB-BIOLOGY MAX MARKS -70 General Instructions :1. There are a total of 27 questions and five sections in the question paper. All questions are compulsory 2. Section A contains question numbers 1 to 5 ,multiple choice questions of one mark each. Section B contains question numbers 6 to 12, short answer type I questions of two marks each. Section C contains question numbers 13 to 21, short answer type II questions of 3 marks each . Section D contains question numbers 22 to 24, case based short answer type questions of three marks each. Section E contains question numbers 25 to 27, long answer type questions of five marks each. 3. There is no overall choice in the question paper. However internal choices are provided in two questions of one mark, one question of 2 marks, two questions of three marks and all the three questions of 5 marks . An examinee is to attempt any one of the questions out of the two given in the question paper with the same question number. -----------------------------------------------------------------------------------------------------------SECTION A 1. Which of the following statements is true of yeast: 1 a) Cell divides by binary fission; one of the daughter cell develops into a bud. b)Cell divides unequally; smaller cell develops into a bud. c)Cell produces conidia, which develop into a bud. d)Cell divides by meiosis, four haploid buds are produced. OR Which of the following will create genetic variation? a) b) c) d) 1 Geitonogamy Cleistogamy Autogamy Xenogamy 2. The bio fortified maize hybrid developed in the year 2000 was rich in which of the following two amino acids 1 a) Lysine and Arginine b) Arginine and tryptophan c) Lysine and tryptophan d) Glycine and tryptophan Page 1 of 8 3. Choose the correct pair to fill in the blanks (i) and (ii) 1 The bacterium that would be used for cloning genes in Soyabean plant is __(i)_____, and the one that is used for carrying out amplification of DNA in PCR reaction at high temperature is (ii)______ (a) (i) Bacillus thuringiensis and (ii) Thermos aquaticus (b) (i) Agrobacterium tumefactions and (ii) Thermus aquaticus (c) (i) E. coli and (ii) Thermus aquaticus (d) (i) E.coli and (ii) Salmonella tyhimurium 4. What was the source of the gene that initiated RNAi in the tobacco plant against the nematode Meloidegyne incognitia? 1 a) Agrobacterium tumifaciens b) Bacillus thuringiensis c) Tobacco plant d) Meloidegyne incognitia OR The DNA formed by joining together DNA from two different organisms is called; a) b) c) d) a DNA r DNA c DNA z DNA 5. Study the biome distribution with respect to annual temperature and precipitation from the following graph Identify A, B. 1 Page 2 of 8 a) b) c) d) A: Tropical forest, B: Tundra A: Temperate forest B: Tropical forest A: Tundra, B: Tropical forest A: Tropical forest, B: Temperate forest (FOR VISUALLY IMPAIRED STUDENTS ONLY) In a given habiat A , the mean annual precipitation is in the range of 150-450 cm and the mean annual temperature varies from 20-25 C, while in habitat B the mean annual precipitation is in the range of 50-200 cm and the mean annual temperature varies from 8-23 C. Which of the following correctly names the habitats A and B? 1 a) A: Tropical forest, B: Tundra b) A: Temperate forest B: Tropical forest c) A: Tundra, B: Tropical forest d) A: Tropical forest, B: Temperate forest SECTION B 6.Differentiate between isogamy and anisogamy with examples. 2 7.In pea plants flowers are either violet or white in colour, but in humans, 2 8 .If haploid content of human DNA is 3.3 x10 9 bp & the distance between two consecutive bp is 0.34 x 10 -9 m. Calculate the length of diploid DNA present in cell. 2 OR S strain Injected into mice ----q------ Injected into mice -------p-------Mice lived Write appropriate phrases in place of p and q above. What was this experiment about and who performed it? 9. A person has been detected to be suffering from stomach cancer by doctors. (i) Name any two techniques that could have been used by the doctor for the Detection of cancer (ii) How do interferons help in controlling cancer? Page 3 of 8 2 10. How does the air that is pumped in eventually helps in reducing the BOD? 2 11. Name the enzymes involved in the following process 2 (i) Inspecting the DNA length for palindromic nucleotide sequence (ii) Joining of DNA fragments (iii) Breaking of cell of bacterium to release DNA and other macromolecules (iv) Removing nucleotides from the end of DNA. 12.Due to predator attack on a given population, several young ones were + +1 killed and most aged individuals could not escape either. Which of the age pyramids given below will ideally represent the situation? Why? What would be the growth status of this population? (FOR VISUALLY IMPAIRED STUDENTS ONLY) . Due to predator attack on a given population, several young ones were killed and most aged individuals could not escape either. Name the type of age pyramid that will ideally represent the situation? Why? What would be the growth status of this population? SECTION C 13. i) Expand IUT. 1+1+1 ii) In which part of the female reproductive system the 8 celled embryo will be transferred during test tube baby program iii) Write one difference between GIFT and ZIFT. 14. What do you mean by inbreeding depression? Describe any 4 methods to solve this problem during animal breeding? 3 15.Study the figures (a) and (b) given below and answer the questions given after the graphs Page 4 of 8 3 (ii) Under the influence of which type of Natural Selection would graph (a) become like graph (b)? (iii) What could be the likely reasons of new variations arising in the population? (iv) Who suggested Natural Selection as a mechanism of evolution? 1+1+1 (FOR VISUALLY IMPAIRED STUDENTS ONLY) 15. (i) State the Hardy- Weinberg Principle. 1+1+1 (ii) What could be the likely reasons of new variations arising in the population? (iii) Who suggested Natural Selection as a mechanism of evolution? 16.In the following diagram the two DNA strands represented are ready for transcription 3 (a)Label the parts marked 1 to 4. (b)Which one of the two strands of DNA has nucleotide sequence similar to the mRNA that will be transcribed and why? OR Page 5 of 8 If a true breeding homonzygous pea plant with green pod and axial flower as dominant characters is crossed with a recessive homonzygous pea plant with yellow pods and terminal flowers, then what would be the: 3 (a)phenotype and genotype of the F1 offspring; (b)phenotypic distribution ratio in F2 population? 17.Represent schematically the life cycle of malarial parasite. 3 (FOR VISUALLY IMPAIRED STUDENTS ONLY) 17. Name the most fatal pathogen species of malaria. At which stage of life cycle does it enter the humans? In which organs does it reproduce asexually? What causes cyclic fevers and chills in malaria patient? 3 18..In a bacterial culture some of the colonies produced blue colour in the presence of a chromogenic substrate and some did not, due to the presence of an insert (rDNA) in the coding sequence of -galactosidase. 2+1 (a)Mention the mechanism and the steps involved in the above experiment. (b)How is it advantageous over simultaneous plating on two plates having different antibiotics? 19.Name three classes of insects pests against which Bt toxins are effective. How do Bt toxins control the pest population in a crop field? OR Discuss the role of microbes as biofertilizers 3 20.Read the sequence of the nucleotides in the given segment of mRNA, which shows seven codons marked 1-7. 3 AUGUUUAUGCCUGUUUCUUAA 1 2 3 4 5 6 7 (a)What would be the difference in functioning of codon 1 and 3? (b)Write the nucleotide sequence of the DNA strand from which this mRNA was transcribed. Page 6 of 8 (c)What does the last codon of this RNA stand for.? 21.A survey of latitudinal gradients of bio-diversity of birds is as follows: India 20o North ----- 1200 Species England 55o North ------ 600 species 3 Greenland 71o North ------ 55 Species This data indicates that the distribution of birds on earth is affected by the distance of the habitat from the equator. Describe three reasons which account for this variation in biodiversity of birds at different places. SECTION D 22.Neeru is 16 years old and her younger sister Geetu 11 years old. They were watching TV one day when during a commercial break, an advertisement for promoting use of sanitary napkins was flashed. Geetu got curious about the use of sanitary pads. Explain what Neeru would answer when Geetu asks the following questions: 3 a)Why is it important to use proper sanitary napkins during menstruation? b)Why does menstrual flow begin at puberty and not before? c)What role does the brain (pituitary gland) play in regulating the menstrual cycle in humans? 23. You have been deputed by your school principal to train local villagers in the use of biogas plant. With the help of a labeled sketch, explain the various parts and functioning of the biogas plant. 3 24. In a simple ecosystem, there exists a field of wheat. Mice eat the wheat and snakes eat the mice.The snakes are in turn eaten by eagles. If 10,000 calories are available from wheat plants, how much energy would each of the trophic levels in the food chain receive? Draw a pyramid to depict the energy at each trophic level also. 3 SECTION E 25a. Show diagrammatically the stages of embryonic development from zygote upto implantation in humans, inside the female reproductive system. b. Also, name the following: 3+2 i. Stage of embryo at which implantation occurs. ii. Type of division which takes place in zygote during formation of early embryo. iii. Stage of embryo with 8 16 blastomeres. Page 7 of 8 iv. Outermost layer of the embryonic stage that gets implanted. OR (a)Draw the embryo sac of a flowering plant and label (i) central cell (ii) synergids. Also mention the functions of these cells. (b)Name the cell that develops into the embryo sac. Describe the steps of development of the Embryo sac. 2 +2 26.In a medium where E.coli was growing, lactose was added , which induced the lac operon. But after sometime, it was observed that the lac operon was shut down. Why did this happen? Explain. Also differentiate between inducer and repressor of an operon. 3+2 OR Answer the following: 3+2 (a)Write the conclusion Mendel arrived, at dominance of traits on the basis of monohybrid crosses that he carried out in Pea plant. (b) Explain Why a recessive allele in unable to express itself in heterozygous state? 27 (a)When a species becomes extinct, the plant and animal species associated with it in an obligatory way also becomes extinct. But nature has a unique way to prevent this extinction. What is this mechanism called? Cite an example to explain the mechanism. (b) During temporary harsh environmental conditions, some animals undergo hibernation and aestivation but many others animals living in the same habitat do not show any such process. Explain how do other animals survive in such conditions? 2+3 OR (a)It was found that high concentrations of DDT accumulated in certain fish eating birds, that caused a massive decline in their population. Explain the phenomenon by virtue of which DDT would have accumulated in such high amounts in the birds and lead to their deaths. (b)What is cultural eutrophication? Explain the causes and effects of cultural eutrophication.2+3 End of the paper Page 8 of 8

Formatting page ...

Related ResPapers
CBSE Class 12 Pre Board 2021 : Biology (Kendriya Vidyalaya (KV) No 1, Armapur, Kanpur)
by cbse12_pre_boards 
CBSE Class 12 Pre Board 2019 : Biology (Kendriya Vidyalaya (KV), Chennai Region)
by cbse12_pre_boards 
CBSE Class 12 Pre Board 2021 : Biology - Set 1 (CBSE Gulf Sahodaya Qatar Chapter, Doha)
by cbse12_pre_boards 
CBSE Class 12 Pre Board 2021 : Biology (Kendriya Vidyalaya (KV), Lucknow Region)
by cbse12_pre_boards 

Formatting page ...

Formatting page ...

Formatting page ...

Formatting page ...

Formatting page ...

Formatting page ...

 

  Print intermediate debugging step

Show debugging info


 


Tags : cbse pre boards, prelims 2015 - 2016, preliminary examinations, central board of secondary education, india schools, free question paper with answers, twelfth standard, xiith std, board exams, mock, model, sample, specimen, past, free guess papers.india, delhi, outside delhi, foreign, cbse class xii, cbse 12, 12th standard, cbse papers, cbse sample papers, cbse books, portal for cbse india, cbse question bank, cbse question papers with answers, pre board exam papers, cbse model test papers, solved board question papers of cbse last year, previous years solved question papers, free online cbse solved question paper, cbse syllabus, india cbse board sample questions papers, last 10 years cbse questions papers, cbse important questions, specimen / mock papers.  


© 2010 - 2026 ResPaper. Terms of ServiceContact Us Advertise with us

 

cbse12_pre_boards chat