Trending ▼   ResFinder  

CBSE Class 12 Pre Board 2020 : Biology - Prelim 1 (Delhi Public School (DPS), Jammu)

2 pages, 20 questions, 0 questions with responses, 0 total responses,    0    0
CBSE 12 Pre Boards
  
+Fave Message
 Home > cbse12_pre_boards >   F Also featured on: School Page cbse12

Formatting page ...

DELHI PUBLIC SCHOOL, JAMMU Assignment Pre Board I Session: 2019-20 Class XII Sub: Biology Topics included are: 1. Reproduction in organisms, Sexual reproduction in flowering plants, Human reproduction and Reproductive health. 2. Principles of Inheritance and Variation, Molecular Basis of Inheritance, Evolution. 3. Human Health and Diseases, Strategies for Enhancement in Food Production, Microbes in Human welfare. 4. Biotechnology: Principles and Processes, Biotechnology and its applications. Q1. Why are exonucleases not useful in genetic engineering? Q2. Why should a bacterial cell be made competent to introduce rDNA into it? Q3. Given below is the nucleotide sequence of a hypothetical mRNA and amino acids coded by this mRNA: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Describe the properties of genetic code that can be correlated from the above given information. Q4. How Innate Immunity is is different from Acquired immunity? Describe any two ways by which innate immunity can be accomplished. Q5. State the functions of primary and secondary lymphoid organs in humans. Q6. Name two commonly used vectors in rDNA technology. Enlist and explain the three characteristic features of cloning vectors. Q7. Write the scientific name of the source plants and the effect on the human body of these drugs. i) Morphine ii) Cocaine iii) Marijuana Q8. Trace the development of a zygote of a dicot angiosperm into a fully developed embryo. Q9. Mention two objectives of setting up GEAC by our Government. Q10. Expand MOET and what is the role of genetic mother in MOET? Q11. What is aminoacylation? State its significance. Q12. p2+2pq+q2=1. Explain this algebraic equation on the basis of Hardy Weinberg s principle. Q13. Write the characteristics of Ramapithecus, Dryopithecus and Neanderthal man. Q14. Explain the following phases in the menstrual cycle of a human female.

Formatting page ...

 

  Print intermediate debugging step

Show debugging info


 


Tags : cbse pre boards, prelims 2015 - 2016, preliminary examinations, central board of secondary education, india schools, free question paper with answers, twelfth standard, xiith std, board exams, mock, model, sample, specimen, past, free guess papers.india, delhi, outside delhi, foreign, cbse class xii, cbse 12, 12th standard, cbse papers, cbse sample papers, cbse books, portal for cbse india, cbse question bank, cbse question papers with answers, pre board exam papers, cbse model test papers, solved board question papers of cbse last year, previous years solved question papers, free online cbse solved question paper, cbse syllabus, india cbse board sample questions papers, last 10 years cbse questions papers, cbse important questions, specimen / mock papers.  

© 2010 - 2021 ResPaper. Terms of ServiceContact Us Advertise with us

 

ICSE Q&A - Ask and Answer
cbse12_pre_boards chat